View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4718-Insertion-16 (Length: 314)
Name: NF4718-Insertion-16
Description: NF4718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4718-Insertion-16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 42141076 - 42140989
Alignment:
| Q |
9 |
taacgcgacaggacgaggtggccgtgaaccttatgggtcagcctagaaatgtggcagcgtattataatgtcgattagggcattagcgg |
96 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42141076 |
taacgcgacaggacgaggtggccgtgaaccttatgggtcagcctagaaatgtggcagcgtattataatgtcgattagggcattagcgg |
42140989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 113 - 230
Target Start/End: Complemental strand, 42140994 - 42140879
Alignment:
| Q |
113 |
tagcggattaaggctttctttgatnnnnnnnngatagtaaattgttgataaactaacttatagcggttagtattannnnnnnnataaatagaaattattg |
212 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
42140994 |
tagcggattaaggctttctttgataaaaaaa-gatagtaaattgttgataaactaacttatagctgttagtatt-ttttttttataaatagaaattattg |
42140897 |
T |
|
| Q |
213 |
gtagactcttccatcaag |
230 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42140896 |
gtagactcttccatcaag |
42140879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University