View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4718_high_9 (Length: 323)
Name: NF4718_high_9
Description: NF4718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4718_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 7e-77; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 7e-77
Query Start/End: Original strand, 6 - 155
Target Start/End: Original strand, 30874203 - 30874352
Alignment:
| Q |
6 |
aactaggtcaagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttctaggtcagggcgttgaaggcgatgaacaaag |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
30874203 |
aactaggtcaagcccttcatggttattgttgttgtttccatcttggtcttgactctcatcatgaacttctaggtcaggacgttgaaggcgatgaacaaag |
30874302 |
T |
|
| Q |
106 |
tgttgtgatgctgaacccaagtctatgccggccatatactcaaagttttc |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30874303 |
tgttgtgatgctgaacccaagtctatgccggccatatactcaaagttttc |
30874352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 235 - 317
Target Start/End: Original strand, 30874432 - 30874514
Alignment:
| Q |
235 |
gaacaattaaattatatgtaaacaggaattataaannnnnnnatagaaaagaaagtattagatttaggagtgtcctatgattc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
30874432 |
gaacaattaaattatatgtaaacaggaattataaaattttttatagaaaagaaagtattagatttaggagtgtccaatgattc |
30874514 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University