View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4718_low_12 (Length: 312)
Name: NF4718_low_12
Description: NF4718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4718_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 22 - 296
Target Start/End: Complemental strand, 45512512 - 45512238
Alignment:
| Q |
22 |
gacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttccatgatgaaagcttgtttggtgaatcatgtgcaatg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512512 |
gacaacatgtctagtaacattgtcacaaccaatgccttcccattggcaacagtgagtgcctttccatgatgaaagcttgtttggtgaatcatgtgcaatg |
45512413 |
T |
 |
| Q |
122 |
gatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacacacaagcatatttgtgcaatttcaatcaacaccaaaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512412 |
gatgctttgaaattgagaagggcttgcctctctttttcaatacaggggatgtttgaatttacacacaagcatatttgtgcaatttcaatcaacaccaaaa |
45512313 |
T |
 |
| Q |
222 |
gtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattgaatgatggttttcat |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45512312 |
gtactacacatttgtaatatcttcccatgttttctatctctgtttctattgaaataattgaatgatggttttcat |
45512238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University