View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4718_low_16 (Length: 275)
Name: NF4718_low_16
Description: NF4718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4718_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 17 - 268
Target Start/End: Complemental strand, 1604309 - 1604058
Alignment:
| Q |
17 |
aaaaactgtaccatatccgaatttcccaacagaaaatcaaaatttacaagctaggtggtgagtgcaactacatggatataatgtccaattttaaggtgga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1604309 |
aaaaactgtaccatatccgaatttcccaacagaaaatcaaaatttacaagctaggtggtgagtgcaactacatggatataatgtccaattttaaggtgta |
1604210 |
T |
|
| Q |
117 |
gaattgaatgtcattggagcagcagttagaaaaatgaaaagtagctagccacactagcaattgagaaaaaacaatactatatcacttgttagctttaagc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1604209 |
gaattgaatgtcattggagcagcagttagaaaaatgaaaagtagctagccactctagcaattgagaaaaaacaatactgtatcacttgttagctttaagc |
1604110 |
T |
|
| Q |
217 |
caatcaaggatacccttttctgcttctgaaagcttcccctcctcctttgctt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1604109 |
caatcaaggatacccttttctgcttctgaaagcttcccctcctcctttgctt |
1604058 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 2e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 197 - 264
Target Start/End: Complemental strand, 48007522 - 48007455
Alignment:
| Q |
197 |
atcacttgttagctttaagccaatcaaggatacccttttctgcttctgaaagcttcccctcctccttt |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48007522 |
atcacttgttagctttaagccaatcaaggatacccttttctgcttctgaaagcttcccctcctccttt |
48007455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 19 - 77
Target Start/End: Complemental strand, 48007630 - 48007571
Alignment:
| Q |
19 |
aaactgtaccatatccgaatttcccaacagaaaatcaaaatttacaagct-aggtggtga |
77 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
48007630 |
aaactgtaccatatccaaattttccaacagaaaatcaaaatttacaagctaaggtggtga |
48007571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University