View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4718_low_5 (Length: 431)
Name: NF4718_low_5
Description: NF4718
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4718_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 106; Significance: 7e-53; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 211 - 320
Target Start/End: Original strand, 28380241 - 28380350
Alignment:
| Q |
211 |
aaagtgttagaatgaaagagaaagagagggtttaagcaaaacacaacaaaaagagtcacggtttgtttgtcttttgtgattctcacatgaaaactttaga |
310 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28380241 |
aaagagttagaatgaaagagaaagagagggtttaagcaaaacacaacaaaaagagtcacggtttgtttgtcttttgtgattctcacatgaaaactttaga |
28380340 |
T |
 |
| Q |
311 |
attccatgtc |
320 |
Q |
| |
|
|||||||||| |
|
|
| T |
28380341 |
attccatgtc |
28380350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 82 - 151
Target Start/End: Original strand, 28380114 - 28380183
Alignment:
| Q |
82 |
gtgtcagagaaaacattaaggaaaacaaaggaaaaagaagcatgagagcattaaaaaggataacattcta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28380114 |
gtgtcagagaaaacattaaggaaaacaaaggaaaaagaagcatgagagcattaaaaaggataacattcta |
28380183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 365 - 414
Target Start/End: Complemental strand, 13397670 - 13397620
Alignment:
| Q |
365 |
ctatgaagcacagacacccct-gaattaggcgtgtctcgatgtcggacatg |
414 |
Q |
| |
|
||||||||||| ||||| ||| ||||||||||||||||| ||||||||||| |
|
|
| T |
13397670 |
ctatgaagcacggacactccttgaattaggcgtgtctcggtgtcggacatg |
13397620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 366 - 413
Target Start/End: Complemental strand, 3658271 - 3658223
Alignment:
| Q |
366 |
tatgaagcacagacacccct-gaattaggcgtgtctcgatgtcggacat |
413 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||| |||||||||||| |
|
|
| T |
3658271 |
tatgaagcacggacactcctcgaattaggcgtgtcttgatgtcggacat |
3658223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University