View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719-Insertion-13 (Length: 131)
Name: NF4719-Insertion-13
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719-Insertion-13 |
 | |
|
| [»] chr1 (3 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 124; Significance: 3e-64; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 124; E-Value: 3e-64
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 46734475 - 46734352
Alignment:
| Q |
8 |
atctattcacattgaataggattgtaacataaccgcgacaacaatcacaatttgaaacctagattcgaggctgaaagaacaaacctagagagaatatgat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46734475 |
atctattcacattgaataggattgtaacataaccgcgacaacaatcacaatttgaaacctagattcgaggctgaaagaacaaacctagagagaatatgat |
46734376 |
T |
|
| Q |
108 |
accttatactatctaattacattg |
131 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
46734375 |
accttatactatctaattacattg |
46734352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 4e-33
Query Start/End: Original strand, 8 - 131
Target Start/End: Complemental strand, 46734585 - 46734462
Alignment:
| Q |
8 |
atctattcacattgaataggattgtaacataaccgcgacaacaatcacaatttgaaacctagattcgaggctgaaagaacaaacctagagagaatatgat |
107 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||||| |||||||||| || ||||||||||| || |||||||||||||| ||||||||| || |
|
|
| T |
46734585 |
atctaatcacattgaataggattgtaacaataccgcgacaacgatcacaatttaaatcctagattcgatgccgaaagaacaaacctcgagagaatacaat |
46734486 |
T |
|
| Q |
108 |
accttatactatctaattacattg |
131 |
Q |
| |
|
||||||||||||||| | |||||| |
|
|
| T |
46734485 |
accttatactatctattcacattg |
46734462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 55 - 131
Target Start/End: Complemental strand, 46734648 - 46734572
Alignment:
| Q |
55 |
caatttgaaacctagattcgaggctgaaagaacaaacctagagagaatatgataccttatactatctaattacattg |
131 |
Q |
| |
|
|||||| |||||||||||||| ||||||| |||||| || |||||| | ||||||||||||||||||| |||||| |
|
|
| T |
46734648 |
caatttaaaacctagattcgatgctgaaacaacaaatcttgagagaggacaataccttatactatctaatcacattg |
46734572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University