View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719-Insertion-14 (Length: 151)
Name: NF4719-Insertion-14
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719-Insertion-14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 8 - 135
Target Start/End: Original strand, 43599158 - 43599285
Alignment:
| Q |
8 |
aatttctcaagaaaaagtgatagtgagttagaccatttcaatgctcaattaaggtgggttttgatgttttgatacacctgtagttgttatgattctttcc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
43599158 |
aatttctcaagaaaaagtgatagtgagttagaccatttcaatgctcaattaaggtgggttttgatgttttgatacccctgtaattgttatgattctttcc |
43599257 |
T |
 |
| Q |
108 |
gttcaattatttttgcttaattcacggg |
135 |
Q |
| |
|
||||||||||||||||||| ||||||| |
|
|
| T |
43599258 |
cttcaattatttttgcttaactcacggg |
43599285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University