View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719-Insertion-16 (Length: 278)
Name: NF4719-Insertion-16
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719-Insertion-16 |
 | |
|
| [»] chr4 (7 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 235; Significance: 1e-130; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 8 - 278
Target Start/End: Complemental strand, 52986002 - 52985732
Alignment:
| Q |
8 |
gaagggagtaaaatgtaatagcagtagaactgggannnnnnnngctgaacaccataactctgaaattgtaggctgtgcgggcactaggaaacgttgccgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
52986002 |
gaagggagtaaaatgtaatagcagtagaactgggattttttttgctgaacaccataactctgaaattgtaggctgtgcgggcattaggaaacgttgccgt |
52985903 |
T |
|
| Q |
108 |
tgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagtt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52985902 |
tgattcccctatgtgccgtgatcttgttttcagtcatggtgccttgatcccattgctatcccagttcaatgatcaaacaaggctttctatgctgagagtt |
52985803 |
T |
|
| Q |
208 |
gccgttgtttttgaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtagga |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52985802 |
gccgttgtttttgaaaaattaaaactgacaccgtaagaagatctttatatgtgtattaattaatagtagga |
52985732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 63 - 210
Target Start/End: Original strand, 55635245 - 55635392
Alignment:
| Q |
63 |
aactctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
162 |
Q |
| |
|
|||||||||||||||||||| | ||||| | ||||||||||||| ||| |||||| |||||||||||||||| ||||| |||||||| |||| ||| || |
|
|
| T |
55635245 |
aactctgaaattgtaggctgcgtgggcattgggaaacgttgccggtgagtccccttggtgccgtgatcttgttctcagtcatggtgccctgattccactg |
55635344 |
T |
|
| Q |
163 |
ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgcc |
210 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||||||||||||| ||||| |
|
|
| T |
55635345 |
ttatcccagttgaatgagcaagcaaggctttctatgctgagaattgcc |
55635392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 70 - 210
Target Start/End: Complemental strand, 55665699 - 55665559
Alignment:
| Q |
70 |
aaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatccc |
169 |
Q |
| |
|
|||||| |||||||| ||||| | |||||| |||||| ||||||||||| |||||||||||||||||||||| ||||||| ||||||| ||||| ||| |
|
|
| T |
55665699 |
aaattgcaggctgtgtgggcattgggaaacattgccggtgattcccctaggtgccgtgatcttgttttcagtcatggtgcgctgatcccgctgttaaccc |
55665600 |
T |
|
| Q |
170 |
agttcaatgatcaaacaaggctttctatgctgagagttgcc |
210 |
Q |
| |
|
|||| ||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
55665599 |
agttgaatgagcaagcaaagctttctatgctgagagttgcc |
55665559 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 63 - 209
Target Start/End: Complemental strand, 55659494 - 55659348
Alignment:
| Q |
63 |
aactctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
162 |
Q |
| |
|
|||||||||||||||||||| | || || | ||||| ||||||| ||||||||||| || |||||||||||| ||||| ||||||| |||||||| || |
|
|
| T |
55659494 |
aactctgaaattgtaggctgcgtggacattgggaaatgttgccggtgattcccctagttgtcgtgatcttgttctcagtcatggtgcgttgatcccgctg |
55659395 |
T |
|
| Q |
163 |
ttatcccagttcaatgatcaaacaaggctttctatgctgagagttgc |
209 |
Q |
| |
|
||||||||||| ||||| ||| ||| |||||||||||||||| |||| |
|
|
| T |
55659394 |
ttatcccagttgaatgagcaagcaaagctttctatgctgagaattgc |
55659348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 67 - 186
Target Start/End: Complemental strand, 54862310 - 54862191
Alignment:
| Q |
67 |
ctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttat |
166 |
Q |
| |
|
||||| ||||||||| | ||||| | |||||| |||| | ||||||||||| ||| |||||||||||| ||||| |||||||| ||||||| |||||| |
|
|
| T |
54862310 |
ctgaatttgtaggctccgtgggcattgggaaacattgctggtgattcccctaggtgtcgtgatcttgttctcagtcatggtgccctgatcccgctgttat |
54862211 |
T |
|
| Q |
167 |
cccagttcaatgatcaaaca |
186 |
Q |
| |
|
||||||| ||||| |||||| |
|
|
| T |
54862210 |
cccagttgaatgaccaaaca |
54862191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 55 - 213
Target Start/End: Original strand, 54627019 - 54627177
Alignment:
| Q |
55 |
aacaccataactctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttga |
154 |
Q |
| |
|
||||||| |||||||||||||||||||| | ||||| | |||||| |||| | ||||||||||| |||||||||||||| ||||| | |||||| ||| |
|
|
| T |
54627019 |
aacaccaaaactctgaaattgtaggctgcgtgggcattgggaaacattgctggtgattcccctagaggccgtgatcttgttctcagtcacggtgccctga |
54627118 |
T |
|
| Q |
155 |
tcccattgttatcccagttcaatgatcaaacaaggctttctatgctgagagttgccgtt |
213 |
Q |
| |
|
||| | | ||||||||| | ||||| ||| | |||||| || ||||||| ||||||| |
|
|
| T |
54627119 |
tcctacttttatcccagctgaatgagcaagaagggctttataggctgagaaatgccgtt |
54627177 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 94 - 209
Target Start/End: Complemental strand, 3672027 - 3671912
Alignment:
| Q |
94 |
ggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattgttatcccagttcaatgatcaaacaaggcttt |
193 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||| ||||| |||||||| ||||||| |||||||||| || ||||| | ||| ||| |
|
|
| T |
3672027 |
ggaaacgttgcctgtgattcccctagttgccgtgatcttgttctcagtcatggtgccatgatcccgctgttatcccacttgaatgagcttacagatattt |
3671928 |
T |
|
| Q |
194 |
ctatgctgagagttgc |
209 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
3671927 |
ctatgctgagagttgc |
3671912 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 51 - 179
Target Start/End: Original strand, 9889518 - 9889646
Alignment:
| Q |
51 |
gctgaacaccataactctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgcc |
150 |
Q |
| |
|
||||||||| | ||||||||||||||||||| | |||| | |||||||||||| ||||||||||| |||||| |||||||| ||||| |||||||| |
|
|
| T |
9889518 |
gctgaacactaaaactctgaaattgtaggcttcgtgggcgttgggaaacgttgcctgtgattcccctagttgccgttatcttgttctcagtcatggtgcc |
9889617 |
T |
|
| Q |
151 |
ttgatcccattgttatcccagttcaatga |
179 |
Q |
| |
|
||||||| |||||||||| || ||||| |
|
|
| T |
9889618 |
atgatcccgctgttatcccacttgaatga |
9889646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 63 - 204
Target Start/End: Original strand, 13401423 - 13401564
Alignment:
| Q |
63 |
aactctgaaattgtaggctgtgcgggcactaggaaacgttgccgttgattcccctatgtgccgtgatcttgttttcagttatggtgccttgatcccattg |
162 |
Q |
| |
|
||||||| |||||||||||||| ||||| | ||||| ||||| | |||||| |||| |||||| ||||||||| | || |||||||| ||||||| || |
|
|
| T |
13401423 |
aactctgtaattgtaggctgtgtgggcattgggaaatgttgctggtgattcacctaggtgccgcgatcttgttcttagccatggtgccctgatcccgctg |
13401522 |
T |
|
| Q |
163 |
ttatcccagttcaatgatcaaacaaggctttctatgctgaga |
204 |
Q |
| |
|
||| ||||||| ||||| || ||| |||||| ||||||||| |
|
|
| T |
13401523 |
ttaacccagttgaatgagcaggcaaagctttcaatgctgaga |
13401564 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University