View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719-Insertion-17 (Length: 70)
Name: NF4719-Insertion-17
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719-Insertion-17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 45; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 2e-17
Query Start/End: Original strand, 8 - 56
Target Start/End: Original strand, 2115978 - 2116026
Alignment:
| Q |
8 |
gtacgatgtctagattaggatattgaagtacagtatagttttggaatca |
56 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2115978 |
gtacgatgtctagattaagatattgaagtacagtatagttttggaatca |
2116026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University