View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719-Insertion-26 (Length: 234)
Name: NF4719-Insertion-26
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719-Insertion-26 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 7 - 234
Target Start/End: Complemental strand, 26553402 - 26553175
Alignment:
| Q |
7 |
atgtcctcgtcagcagaagccattggtacattcccctccaacagattcaccgagtccatatacatattctaacaaaaatacaagaatcagaaaagaaata |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26553402 |
atgtcctcgtcagcagaagccattggtacattcccctccaacagattcaccgagtccatatacatattctaacaaaaatacaagaatcagaaaagaaata |
26553303 |
T |
|
| Q |
107 |
annnnnnngacagcatacaatacaaagagcatgcactttcacatctattaacaaattaaggttatttccaaaggcaaataaggtaggcactactcaaggt |
206 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
26553302 |
attgttttgacagcatacaatacaaagagcatgcactttcacatctattaacaaattagggttatttccaaagacaaataaggtaggcactactcaaggt |
26553203 |
T |
|
| Q |
207 |
tgttggattcaactatttatttacttta |
234 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
26553202 |
tgttggattcaactatttatttacttta |
26553175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University