View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_high_19 (Length: 245)
Name: NF4719_high_19
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 241
Target Start/End: Original strand, 2893125 - 2893365
Alignment:
| Q |
1 |
atagaatatataatcgtgtcaattttaactatgaataccctaaggtcgaataatcacagggtccccgccaaccgggtggaatcaaaccctttatggtgta |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893125 |
atagaatatataatcttgtcaattttaactccggataccctaagagcgaataatcacagggtccccgccaaccgggtggaatcaaaccctttatggtgta |
2893224 |
T |
 |
| Q |
101 |
tttccctcacaattattattaatcatagaagataaactttcttgattaatataaacacttctcattattcaaattctagcatatttgtataacttactac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893225 |
tttccctcacaattattattaatcatagaagataaactttcttgattaatataaacacttctcattattcaaattctagcatatttgtataacttactac |
2893324 |
T |
 |
| Q |
201 |
gtaccttgatttactttcaagtagtcatatctagttcatat |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2893325 |
gtaccttgatttactttcaagtagtcatatctagttcatat |
2893365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University