View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4719_high_25 (Length: 205)

Name: NF4719_high_25
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4719_high_25
NF4719_high_25
[»] chr5 (2 HSPs)
chr5 (106-205)||(42024884-42024985)
chr5 (1-45)||(42025044-42025088)


Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 106 - 205
Target Start/End: Complemental strand, 42024985 - 42024884
Alignment:
106 cttggattttttgtttctgtactagaagatctctttgaagatgacattctgtgatacgtgatgtggatggacatcttcaagagtcgatg--ttaggtgtg 203  Q
    |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||  |||||||||    
42024985 cttggattttttgtttctgtgctagaagatctctttgaagatgacattctgtgatacgtgatgtggatgtacatcttcaagagtcggtgtcttaggtgtg 42024886  T
204 gt 205  Q
    ||    
42024885 gt 42024884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42025088 - 42025044
Alignment:
1 ttagttgttactatatttcctgtattcgaaattaagtggtccttt 45  Q
    |||| |||||||||||||||| ||||| |||||||||||||||||    
42025088 ttaggtgttactatatttcctctattctaaattaagtggtccttt 42025044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University