View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_high_25 (Length: 205)
Name: NF4719_high_25
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_high_25 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 79; Significance: 4e-37; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 106 - 205
Target Start/End: Complemental strand, 42024985 - 42024884
Alignment:
| Q |
106 |
cttggattttttgtttctgtactagaagatctctttgaagatgacattctgtgatacgtgatgtggatggacatcttcaagagtcgatg--ttaggtgtg |
203 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || ||||||||| |
|
|
| T |
42024985 |
cttggattttttgtttctgtgctagaagatctctttgaagatgacattctgtgatacgtgatgtggatgtacatcttcaagagtcggtgtcttaggtgtg |
42024886 |
T |
 |
| Q |
204 |
gt |
205 |
Q |
| |
|
|| |
|
|
| T |
42024885 |
gt |
42024884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 1 - 45
Target Start/End: Complemental strand, 42025088 - 42025044
Alignment:
| Q |
1 |
ttagttgttactatatttcctgtattcgaaattaagtggtccttt |
45 |
Q |
| |
|
|||| |||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42025088 |
ttaggtgttactatatttcctctattctaaattaagtggtccttt |
42025044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University