View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_low_12 (Length: 288)
Name: NF4719_low_12
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_low_12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 108 - 268
Target Start/End: Original strand, 3253746 - 3253906
Alignment:
| Q |
108 |
gtgttcaatatactgattaagtagatatggtatgatcttattgtctgctcaatggcataggtaatgaaattatcaatcaatttaatagttatcatccctg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3253746 |
gtgttcaatatactgattaagtagatatggtatgatcttattgtctgctgaatggcataggtaatgaaattatcaatcaatttaatagttatcatccctg |
3253845 |
T |
 |
| Q |
208 |
cttatgtagcaggtgctgaaaattttactttactcgtattaattttatgttgattaatctg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3253846 |
cttatgtagcaggtgctgaaaattttactttactcgtattaatttgatgttgattaatctg |
3253906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 207
Target Start/End: Complemental strand, 3084952 - 3084850
Alignment:
| Q |
101 |
gatgcaggtgttcaatatactgattaagtagatatggtatgatcttattgtctgctcaatggcataggtaatgaaattatcaatcaatttaatagttatc |
200 |
Q |
| |
|
||||| ||||||||||||| ||||||||||| || ||| |||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3084952 |
gatgctggtgttcaatata---attaagtagatttg-tatcatcttattgtctgctcaatgccataggtaatgaaattatcaatcaatttaatggttatc |
3084857 |
T |
 |
| Q |
201 |
atccctg |
207 |
Q |
| |
|
||||||| |
|
|
| T |
3084856 |
atccctg |
3084850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University