View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_low_13 (Length: 280)
Name: NF4719_low_13
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 276
Target Start/End: Original strand, 6358550 - 6358822
Alignment:
| Q |
18 |
attatcccatttctttgttatttttctaatcatgattttatcatatagctgcatgctt-gcccaattcagtgttggcttttgagggaaagatagcatcag |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358550 |
attatcccatttctttgttatttttctaatcatgattttatcatatagctgcatgctttgcccaattcagtgttggcttttgagggaaagatagcatcag |
6358649 |
T |
|
| Q |
117 |
taggtgatttgtagcat-----caaaggaactgaggtatgtgttttatttt--------ttatctcgtctaagtagaagttaccatttgcaataataagt |
203 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358650 |
taggtgatttgcagcatgtacccaaaggaactgaggtatgtgttttttttttattttttttatctcgtctaagtagaagttaccatttgcaataataagt |
6358749 |
T |
|
| Q |
204 |
tcacttatagagcaagaaatgtcattcaaagattatttatgcatactcagcaaaacttggattcgagaccttt |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6358750 |
tcacttatagagcaagaaatgtcattcaaagattatttatgcatactcagcaaaacttggattcgagaccttt |
6358822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University