View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_low_17 (Length: 248)
Name: NF4719_low_17
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 41870337 - 41870098
Alignment:
| Q |
1 |
gtcttgtgtgtgtcttgagcagggcagcaaggatggtctatgtccacttgagaagttagagaccactcggaagaagatgaaagcgctcaatgagctgcat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41870337 |
gtcttgtgtgtgtcttgagcagggcagcaaggatggtctatgtccacttgagaagttagagaccactcggaagaagatgaaagcgctcaatgagctgcat |
41870238 |
T |
|
| Q |
101 |
gtcattgatggtggtgatcactcttttaagattggtaaaaagcatctgcaagcaaacggttccactcaggatgaagccgaagttgctgctgtgaaggcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41870237 |
gtcattgatggtggtgatcactcttttaagattggtaaaaagcatctgcaagcaaacggttccactcaggatgaagccgaagttgctgctgtgaaggcca |
41870138 |
T |
|
| Q |
201 |
ttgctgctttcatttccaaatctcttgaaggatgatgatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41870137 |
ttgctgctttcatttccaaatctcttgaaggatgatgatg |
41870098 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University