View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_low_18 (Length: 247)
Name: NF4719_low_18
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 17 - 198
Target Start/End: Original strand, 26671844 - 26672018
Alignment:
| Q |
17 |
gtatattgttattgacaaatttgaatatgtatttttctacttannnnnnnctttccaaaaagctaaaataattagctcaatacaccacctgttctctatt |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
26671844 |
gtatattgttattgacaaatttgaatatgtatttttctacttatttttttctttccaaaaagcttaaataattagctcaatacaccacgtgttctctatt |
26671943 |
T |
 |
| Q |
117 |
ttggatttacaaatgaaaaatgaaagcatgaaagggactttagcctttagcctctagttgcccgatgtgctctacgtgttgc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
26671944 |
ttggatttacaaatgaaaaatgaaagcatgaaagggactttagcctt-------tagttgcccgatatgctctacgtgttgc |
26672018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University