View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4719_low_23 (Length: 231)

Name: NF4719_low_23
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4719_low_23
NF4719_low_23
[»] chr1 (4 HSPs)
chr1 (95-217)||(37622767-37622889)
chr1 (3-56)||(39986169-39986222)
chr1 (1-56)||(37622928-37622983)
chr1 (166-217)||(39986311-39986362)


Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 95 - 217
Target Start/End: Complemental strand, 37622889 - 37622767
Alignment:
95 aaacaatattatagatcacttattatattcttggattctaacatatcatactaaaacaaaaaagtagctacatattgataactactagatcgatggatag 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37622889 aaacaatattatagatcacttattatattcttggattctaacatatcatactaaaacaaaaaagtagctacatattgataactactagatcgatggatag 37622790  T
195 gaagaaaaacagtggtgattttt 217  Q
    |||||||||||||||||||||||    
37622789 gaagaaaaacagtggtgattttt 37622767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 39986169 - 39986222
Alignment:
3 ggggacattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg 56  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||    
39986169 ggggtcattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg 39986222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 37622983 - 37622928
Alignment:
1 acggggacattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg 56  Q
    |||||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
37622983 acggggacattggtcggttcttgtcaacaaaaagggtcaaacaatagacccccacg 37622928  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 39986311 - 39986362
Alignment:
166 atattgataactactagatcgatggataggaagaaaaacagtggtgattttt 217  Q
    |||||||  |||| |||||||||||||||||||||||||| |||||||||||    
39986311 atattgagcactaatagatcgatggataggaagaaaaacaatggtgattttt 39986362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University