View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4719_low_23 (Length: 231)
Name: NF4719_low_23
Description: NF4719
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4719_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 2e-63; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 95 - 217
Target Start/End: Complemental strand, 37622889 - 37622767
Alignment:
| Q |
95 |
aaacaatattatagatcacttattatattcttggattctaacatatcatactaaaacaaaaaagtagctacatattgataactactagatcgatggatag |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37622889 |
aaacaatattatagatcacttattatattcttggattctaacatatcatactaaaacaaaaaagtagctacatattgataactactagatcgatggatag |
37622790 |
T |
 |
| Q |
195 |
gaagaaaaacagtggtgattttt |
217 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
37622789 |
gaagaaaaacagtggtgattttt |
37622767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 3 - 56
Target Start/End: Original strand, 39986169 - 39986222
Alignment:
| Q |
3 |
ggggacattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg |
56 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39986169 |
ggggtcattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg |
39986222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 1 - 56
Target Start/End: Complemental strand, 37622983 - 37622928
Alignment:
| Q |
1 |
acggggacattggtcggttcttgtcaacaaaaagtgtcaaacaatagtcccccacg |
56 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
37622983 |
acggggacattggtcggttcttgtcaacaaaaagggtcaaacaatagacccccacg |
37622928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 217
Target Start/End: Original strand, 39986311 - 39986362
Alignment:
| Q |
166 |
atattgataactactagatcgatggataggaagaaaaacagtggtgattttt |
217 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
39986311 |
atattgagcactaatagatcgatggataggaagaaaaacaatggtgattttt |
39986362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University