View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4720_low_9 (Length: 238)
Name: NF4720_low_9
Description: NF4720
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4720_low_9 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 17 - 198
Target Start/End: Complemental strand, 34230730 - 34230548
Alignment:
| Q |
17 |
aggtacattgatacacatcataaatatcaatagcacataatataccagagagctatttgtcatattttagaatttgtattctaaattgagttgcttttta |
116 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34230730 |
aggtagattgatacacatcataaatatcaatagcacataatataccagagagctatttgtcatattttagaatttgtattctaaattgagttgcttttta |
34230631 |
T |
|
| Q |
117 |
gggtgaaggaccgatcaaatctatcatcccacacaaaggacaggtaattttggggataatatt-caatatataaattttgttt |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
34230630 |
gggtgaaggaccgatcaaatctatcatcccacacaaaggacaggtaattttggggataatattacaatatataaattttgttt |
34230548 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University