View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4721-Insertion-10 (Length: 76)
Name: NF4721-Insertion-10
Description: NF4721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4721-Insertion-10 |
 | |
|
| [»] chr3 (3 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 70; Significance: 3e-32; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 70; E-Value: 3e-32
Query Start/End: Original strand, 7 - 76
Target Start/End: Original strand, 13609981 - 13610050
Alignment:
| Q |
7 |
acttggtttggagaatggtggtcaatctgtagaaatgggaacaattcatgctggggactttatgagacga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13609981 |
acttggtttggagaatggtggtcaatctgtagaaatgggaacaattcatgctggggactttatgagacga |
13610050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 48; E-Value: 4e-19
Query Start/End: Original strand, 13 - 76
Target Start/End: Original strand, 14150455 - 14150518
Alignment:
| Q |
13 |
tttggagaatggtggtcaatctgtagaaatgggaacaattcatgctggggactttatgagacga |
76 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||| ||||| |
|
|
| T |
14150455 |
tttggagaatggtggtcaatctgtagaaatgggaacaactcatattggggactttatgggacga |
14150518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.0000000000004
Query Start/End: Original strand, 11 - 76
Target Start/End: Original strand, 14075042 - 14075107
Alignment:
| Q |
11 |
ggtttggagaatggtggtcaatctgtagaaatgggaacaattcatgctggggactttatgagacga |
76 |
Q |
| |
|
||||| |||||||||||||||||| | |||||||||| ||||||| ||||||||||||| ||||| |
|
|
| T |
14075042 |
ggtttagagaatggtggtcaatctattgaaatgggaataattcatattggggactttatgggacga |
14075107 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 52; Significance: 2e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 52; E-Value: 2e-21
Query Start/End: Original strand, 11 - 70
Target Start/End: Complemental strand, 36012486 - 36012427
Alignment:
| Q |
11 |
ggtttggagaatggtggtcaatctgtagaaatgggaacaattcatgctggggactttatg |
70 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36012486 |
ggtttggagaatggcggtcaatctgttgaaatgggaacaattcatgctggggactttatg |
36012427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University