View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4721-Insertion-12 (Length: 207)
Name: NF4721-Insertion-12
Description: NF4721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4721-Insertion-12 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 84 - 206
Target Start/End: Complemental strand, 34953610 - 34953488
Alignment:
| Q |
84 |
ttgtttggtttgagtttttgttggttctatcagcaagaacaatcaccaacagtttctcattctggagacagttatttttgtttccacttatgaagtagtg |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34953610 |
ttgtttggtttgagtttttgttggttctatcagcaagaacaatcaccaacagtttctcattctggagacagttatttttgtttccacttatgaagtagtg |
34953511 |
T |
 |
| Q |
184 |
aggacctgatttaatgagcttga |
206 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
34953510 |
aggacctgatttaatgagcttga |
34953488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 136 - 194
Target Start/End: Original strand, 31394332 - 31394390
Alignment:
| Q |
136 |
tttctcattctggagacagttatttttgtttccacttatgaagtagtgaggacctgatt |
194 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||| |||||| | ||||| ||||||| |
|
|
| T |
31394332 |
tttctcatttttgagacagttatctttgtttccactgatgaagaaatgaggccctgatt |
31394390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University