View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4721-Insertion-6 (Length: 291)
Name: NF4721-Insertion-6
Description: NF4721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4721-Insertion-6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 5 - 291
Target Start/End: Complemental strand, 35277773 - 35277474
Alignment:
| Q |
5 |
acaacaacattgcagccataatttcgaccacatttaaaagaaaaggaaaattatgttgtatcaaactccgaaacaatctaatcaaaccttcatgtatata |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35277773 |
acaacaacattgcagccataatttcgaccacattaaaaagaaaaggaaaattatgttgtatcaaactccgaaacaatctagtcaaaccttcatgtatata |
35277674 |
T |
 |
| Q |
105 |
aatagtgaaatatatttgaattcaat-------------catttaaaataacccaatgataaaatctactgtttgcaaaaataatgtttatagaccaaac |
191 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35277673 |
aatagtgaaatatatttgaattcaatttacaaattcaatcatttaaaataacccaatgataaaatctactgtttgcaaaaataatgtttatagaccaaac |
35277574 |
T |
 |
| Q |
192 |
ttgattgctataactatagaaacaaaaacaaataaaaacatggattagatttaccttattgtcctttgtgtcaaacctctttgcttttttctccatttct |
291 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35277573 |
ttgattgctataactatagaaacaaagacaaataaaaacatggtttagatttaccttattgtcctttgtgtcaaacctctttgcttttttctccatttct |
35277474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University