View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4721_high_13 (Length: 247)
Name: NF4721_high_13
Description: NF4721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4721_high_13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 52 - 247
Target Start/End: Original strand, 50706789 - 50706984
Alignment:
| Q |
52 |
atttttgtttagattaaaatacactcaacatgtaaatgatatatttatcacagtgtaccaaaattaagtggagtagaaaatgtctttttggagatattag |
151 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50706789 |
atttttgtttagattaaaatacacagaacatgtaaaagatatatttatcacagtgtaccaaaattaagtggagtagaaaatgtctttttggagatattag |
50706888 |
T |
|
| Q |
152 |
tgtgtgttattcatgaacttatttttctcgcgaataactacatgataattttttatcgtaaaaaatactatatgataattttattttgtttatact |
247 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50706889 |
tgtgtgttattcatgaagttatttttctcgcgaataactacatgataattttttatcgtaaaaaatactatatgataattttattttgtttatact |
50706984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 20 - 54
Target Start/End: Original strand, 50706742 - 50706776
Alignment:
| Q |
20 |
gatcccattttcttaggggagatttagatatcatt |
54 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
50706742 |
gatcccattttcttaggggagatttagatatcatt |
50706776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University