View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4721_low_5 (Length: 303)
Name: NF4721_low_5
Description: NF4721
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4721_low_5 |
 |  |
|
| [»] scaffold0907 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0907 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: scaffold0907
Description:
Target: scaffold0907; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 14 - 291
Target Start/End: Complemental strand, 2860 - 2584
Alignment:
| Q |
14 |
agttttctctgttaagtctggtttttcatctgggtttcaccttaatcgtaactcacgtgacttctaggtcttgttctagatgatcgcgtggatattaact |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| ||| ||||||||| || |||||||||||||| |
|
|
| T |
2860 |
agttttctctgttaagtctggtttttcatctgggtttcaccttaatcgtaactaacgtgatttctagttctaattctagatggtcacgtggatattaact |
2761 |
T |
 |
| Q |
114 |
agttgtataaataagttctagtagtatttgactatgtgatgtaattggtatttggtaagtatatgtctggaccgacgatgagtatgatagaatcacggtg |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||| |
|
|
| T |
2760 |
agttgtataaataagttctagtagtatttgactatgtgatgtaattggtatttggtaagtatatgt-tggtccgacgatgagtatgatagaatcatggtg |
2662 |
T |
 |
| Q |
214 |
tgttatccaaagtccggtaaaaattatattttgaagttggtctaaatatatgcgaagttgctaactttgttgtagtat |
291 |
Q |
| |
|
|||| |||||||| ||| |||||| |||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2661 |
tgttgtccaaagttcggcaaaaatagtattttaaagtcggtctaaatatatgcgaagttgctaactttgttgtagtat |
2584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University