View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4723-Insertion-10 (Length: 82)
Name: NF4723-Insertion-10
Description: NF4723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4723-Insertion-10 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 71; Significance: 8e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 71; E-Value: 8e-33
Query Start/End: Original strand, 8 - 82
Target Start/End: Original strand, 51039313 - 51039387
Alignment:
| Q |
8 |
gatttgaagaaactctgatcggaacttgatctgagcttcaatggcttccttttcttccattttggaattaacttt |
82 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51039313 |
gatttgaagaaactctgattggaacttgatctgagcttcaatggcttccttttcttccattttggaattaacttt |
51039387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.000000006
Query Start/End: Original strand, 8 - 70
Target Start/End: Original strand, 51045586 - 51045648
Alignment:
| Q |
8 |
gatttgaagaaactctgatcggaacttgatctgagcttcaatggcttccttttcttccatttt |
70 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||| | |||||||| | |||||||||||||| |
|
|
| T |
51045586 |
gatttgaagaaactctgatcggaatttgctctgttcatcaatggcgccattttcttccatttt |
51045648 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University