View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4723-Insertion-11 (Length: 248)
Name: NF4723-Insertion-11
Description: NF4723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4723-Insertion-11 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 8 - 122
Target Start/End: Original strand, 42235056 - 42235170
Alignment:
| Q |
8 |
gttcctgtgtatgcagatccttcaatctcagtcaaaccaaacttctgtgtagtaaaattactaacataaattatattgcaatacatggaaatgtgaacat |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235056 |
gttcctgtgtatgcagatccttcaatctcagtcaaaccaaacttctgtgtagtaaaattactaacataaattatattgcaatacatggaaatgtgaacat |
42235155 |
T |
|
| Q |
108 |
ttgaagaattcccaa |
122 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
42235156 |
ttgaagaattcccaa |
42235170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 169 - 248
Target Start/End: Original strand, 42235216 - 42235295
Alignment:
| Q |
169 |
gtctcacttttcggtcttgaatttgcagcaagtgcttctttggttgaagttgtgtagtgtttttgcgtgtgttaaattgg |
248 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42235216 |
gtctcactttttggtcttgaatttgcagcaagtgcttctttggttgaagttgtgtagtgtttttgcgtgtgttaaattgg |
42235295 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 122
Target Start/End: Original strand, 42260869 - 42260915
Alignment:
| Q |
76 |
aattatattgcaatacatggaaatgtgaacatttgaagaattcccaa |
122 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
42260869 |
aattatattgcattacatggaaatgtgaacatttgaagaattcccaa |
42260915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 76 - 122
Target Start/End: Original strand, 489704 - 489750
Alignment:
| Q |
76 |
aattatattgcaatacatggaaatgtgaacatttgaagaattcccaa |
122 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
489704 |
aattatattgcattacatggaaatgtgaacatttgaagaattcccaa |
489750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University