View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4723_low_4 (Length: 205)

Name: NF4723_low_4
Description: NF4723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4723_low_4
NF4723_low_4
[»] chr7 (1 HSPs)
chr7 (20-195)||(5607591-5607766)


Alignment Details
Target: chr7 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 20 - 195
Target Start/End: Original strand, 5607591 - 5607766
Alignment:
20 taaagtgcttggagatggaactttaaaaaaggctgttgaagcactcctaaatggcatgggctccccctttagaatttatgagaataatttgggaagattg 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
5607591 taaagtgcttggagatggaactttaaaaaaggctgttgaagcactcctaaatggcatgggctcccccttcagaatttatgagaataatttgggaagattg 5607690  T
120 gtgtctcctggagaagtgctgactgcttggctgacaaaacctggagttttcaacttgcttgttctggatgatgtcc 195  Q
    |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||  ||||||||    
5607691 gtgtctcctggagaagtgctgactgcttggttgacaaaacctggagttttcaacttgcttgttctgtctgatgtcc 5607766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University