View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4724-Insertion-10 (Length: 66)
Name: NF4724-Insertion-10
Description: NF4724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4724-Insertion-10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 56; Significance: 5e-24; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 56; E-Value: 5e-24
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 29471181 - 29471126
Alignment:
| Q |
8 |
aattcttgtatgagagtattatccaagtgaatttctgttatattattcatctctcc |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29471181 |
aattcttgtatgagagtattatccaagtgaatttctgttatattattcatctctcc |
29471126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University