View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4724-Insertion-9 (Length: 125)
Name: NF4724-Insertion-9
Description: NF4724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4724-Insertion-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 30247047 - 30246930
Alignment:
| Q |
8 |
catatcatataatgtgaaccgtgtaaaaacacgttaaaaatgtcttccaacaccctacaacattatggatttcataatctgaatcacgggagaaggttgg |
107 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30247047 |
catatcatataatgtgaaccctgtaaaaacacgttaaaaatgtcttccaacaccctacaacattatggatttcataatctgaatcacgtgagaaggttgg |
30246948 |
T |
 |
| Q |
108 |
gaaaataaactctcttat |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
30246947 |
gaaaataaactctcttat |
30246930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University