View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4724_high_8 (Length: 300)
Name: NF4724_high_8
Description: NF4724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4724_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 147; Significance: 2e-77; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 147; E-Value: 2e-77
Query Start/End: Original strand, 1 - 187
Target Start/End: Complemental strand, 46800399 - 46800214
Alignment:
| Q |
1 |
tcccataaaataagggaagccaaatcaaacgtagggcaccacatacaaccatcaacgagaactaacacacatccatccacccatgagaataattgaatat |
100 |
Q |
| |
|
|||| |||||||||||||| |||||||||||| |||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
46800399 |
tcccgtaaaataagggaagtcaaatcaaacgtggggcgccacatacaaccatcaacgggaactaacacacatccatccacccatgagaataactgaatat |
46800300 |
T |
 |
| Q |
101 |
gcctgtcagggttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaattaatcaaagtaatc |
187 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46800299 |
gca-gtcagtgttagattttgtaggccacaatgttttggatatattgtgcatctcattttagacatacacaattaatcaaagtaatc |
46800214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 251 - 283
Target Start/End: Complemental strand, 46800150 - 46800118
Alignment:
| Q |
251 |
gtagctctcagaaaacacgaaatatgtacttaa |
283 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46800150 |
gtagctctcagaaaacacgaaatatgtacttaa |
46800118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University