View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4725-Insertion-8 (Length: 122)
Name: NF4725-Insertion-8
Description: NF4725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4725-Insertion-8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 93; Significance: 1e-45; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 93; E-Value: 1e-45
Query Start/End: Original strand, 8 - 112
Target Start/End: Complemental strand, 27189656 - 27189552
Alignment:
| Q |
8 |
aaaagaaaagagaaagttgatgaaagtgtaggagacggttatatatagttagtgtggtccatactccatagggtttaaccctggccgtcacccttttctt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
27189656 |
aaaagaaaagagaaagttgatgaaagtgtagaagacggttatatatagttagtgtggtccatactccatagggtttaaccctagccgtcacccctttctt |
27189557 |
T |
|
| Q |
108 |
cttct |
112 |
Q |
| |
|
||||| |
|
|
| T |
27189556 |
cttct |
27189552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University