View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4725_high_3 (Length: 332)
Name: NF4725_high_3
Description: NF4725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4725_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 3 - 321
Target Start/End: Complemental strand, 33268996 - 33268678
Alignment:
| Q |
3 |
atcctgagagaagaggagtacgggaatctcgagctgttcctgcacctgatgccaatgctgaactggtagtgtcaatgcaggtaaaatcattgttaatttc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268996 |
atcctgagagaagaggagtacgggaatctcgagctgttcctgcacctgatgccaatgctgaactggtagtgtcaatgcaggtaaaatcattgttaatttc |
33268897 |
T |
|
| Q |
103 |
gatattgtcacaacttgttcatttgtggatttgtcattgctgtttatagatgatattgttctgtttgctgaaatcaaacatcctttcaagtgcatatgtc |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268896 |
gatattgtcacaacttgttcatttgtggatttgtcattgctgtttatagatgatattgttctgtttgctgaaatcaaacatcctttcaagtgcatatgtc |
33268797 |
T |
|
| Q |
203 |
tttttgataaacaccaagatcagttaggtctctcaaatgcatcatatatatcatctggatgaactcttcctttatgcgtcaaataagtatgtgtatggca |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33268796 |
tttttgataaacaccaagatcagttaggtctctcaaatgcatcatatatatcatctggatgaactcttcctttatgcgtcaaataagtatgtgtatggca |
33268697 |
T |
|
| Q |
303 |
tcttaagataaaatgatga |
321 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
33268696 |
tcttaagataaaatgatga |
33268678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University