View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4725_high_8 (Length: 246)
Name: NF4725_high_8
Description: NF4725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4725_high_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 2 - 194
Target Start/End: Original strand, 1079865 - 1080057
Alignment:
| Q |
2 |
catcaaccaatagccttctaaacaatgtccatctcttttacggtgtaacaacacaaaatcggaaatgggcggtgatcctctcttgaattttaattttgtc |
101 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||||||||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1079865 |
catcaaccaatagccttgtaaacattgtccatctcttttacgttgtaacaacacacaatcggaaatgggcggtgattctctcttgaattttaattttgtc |
1079964 |
T |
 |
| Q |
102 |
aaatcgacccaattttgagttgttagtgagtacatcatccaacataaaaccgtaagattgtgcatccacgttgtcggatttgtcaaaagagac |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1079965 |
aaatcgacccaattttgagttgttagtgagtacatcatccaacataaaaccgtaagattgtgcatccacgttgtcggatttgtcaaaagagac |
1080057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 27 - 170
Target Start/End: Complemental strand, 54037413 - 54037269
Alignment:
| Q |
27 |
tgtccatctcttttacggtgtaacaacacaaaatcggaaatgggcggtgatcctctcttgaattttaat-tttgtcaaatcgacccaattttgagttgtt |
125 |
Q |
| |
|
|||| ||||| ||||||||||||||| || ||||||| |||||||||||||||||||| ||||| | |||||||| |||||||||| |||| ||||| |
|
|
| T |
54037413 |
tgtctatctcctttacggtgtaacaatgcacgatcggaagtgggcggtgatcctctcttggatttttagctttgtcaagtcgacccaatattgaattgtt |
54037314 |
T |
 |
| Q |
126 |
agtgagtacatcatccaacataaaaccgtaagattgtgcatccac |
170 |
Q |
| |
|
| |||||||||||||||||||| | | ||||||||||||||||| |
|
|
| T |
54037313 |
actgagtacatcatccaacatagactcttaagattgtgcatccac |
54037269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 199 - 231
Target Start/End: Complemental strand, 54037254 - 54037222
Alignment:
| Q |
199 |
gcacctcccttattcacatactgctcaaccaaa |
231 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
54037254 |
gcacctcccttattcacatactgcttaaccaaa |
54037222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University