View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4725_low_8 (Length: 257)
Name: NF4725_low_8
Description: NF4725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4725_low_8 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 34794305 - 34794084
Alignment:
| Q |
18 |
ttagcatttagttggcaattgttgccgagttcgtaggctaccaacgaggcataacctgtttaaaaggaaggtaatccgtgctacctgctgtgtattgtgt |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34794305 |
ttagcatttggttggcaattgttgccgagttcgtaggctaccaacgaggcataacctgtttaaaaggaaggtaatccgtgcaacctgctgtgtattgtgt |
34794206 |
T |
 |
| Q |
118 |
taaattaaaggtctcaggaattggaaatttttatttgtttaagaggtgtattttatcaatttctatctagtatgaagtgtgtaattgacttggagtggtg |
217 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34794205 |
taaa-----ggtctcaggaattggaaattt--atttgtttaagaggtgtattttatcaatttctatctagtatgaagtgtgtaattgacttggagtggtg |
34794113 |
T |
 |
| Q |
218 |
gttcttttgcttttattgtctccattctt |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
34794112 |
gttcttttgcttttactgtctccattctt |
34794084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University