View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4726_high_1 (Length: 351)
Name: NF4726_high_1
Description: NF4726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4726_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 16 - 336
Target Start/End: Complemental strand, 54385208 - 54384888
Alignment:
| Q |
16 |
caattgtttgctttgtctttgtgtgatcaacacttccattgctgtccaagggtggcaatttcatttccctgatgtttttatgatcaaacgtggaagcaac |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54385208 |
caattgtttgctttgtctttgtgtgatcaacacttccattgttgtccaagggtggcaatttcatttccctgatgtttttatgatcaaacgtggaagcaac |
54385109 |
T |
 |
| Q |
116 |
aaaatatgcaagtcgtctttcggcttcaacagtgtctgattctttgtgcccttagatgattgtaaatttttcaggaacggcataaattagtcttccaaag |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
54385108 |
aaaatatgcaagtcgtctttcggcttcaacagtgtctgattctttgtgcccttagatgattgtaaatttttcaggaacggcataaattagttttccaaag |
54385009 |
T |
 |
| Q |
216 |
caatctttggtgactcctggcctaaaatgtctgatagagaacttgaaatgttctagtatagtatcagtacatggagattcattgtttgacttccattggt |
315 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54385008 |
caatttttggtgactcctggcctaaaatgtctgatagagaacttgaaatgttctagtatagtatcagtacatggagattcattgtttgacttccattggt |
54384909 |
T |
 |
| Q |
316 |
gttccacattatgtttctgtg |
336 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
54384908 |
gttccacattatgtttctgtg |
54384888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University