View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4727-Insertion-12 (Length: 167)
Name: NF4727-Insertion-12
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4727-Insertion-12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 9e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 9e-81
Query Start/End: Original strand, 8 - 167
Target Start/End: Complemental strand, 37940201 - 37940042
Alignment:
| Q |
8 |
cttagcattcccaaaaagagattgatgatcaatgactcaattgttgctaccatgagtagtagtgttgttgctttctttattcatgagtgatgaaattgca |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37940201 |
cttaccattcccaaaaagagattgatgatcaatgactcaattgttgctaccatgagtagtggtgttgttgctttctttattcatgagtgatgaaattgca |
37940102 |
T |
|
| Q |
108 |
gctgcaacagcaagcctaaacttaggatctgatgcaattgcagacacattgttgttatta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37940101 |
gctgcaacagcaagcctaaacttaggatctgatgcaattgcagacacattgttgttatta |
37940042 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University