View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4727_high_17 (Length: 284)
Name: NF4727_high_17
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4727_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 10 - 222
Target Start/End: Complemental strand, 31026276 - 31026064
Alignment:
| Q |
10 |
attatactttcacttcttgaatgatgcttaaattacactaaactctcccataccttataacatacattcttctcctttcttgtgaaaatatatattagga |
109 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| | |||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31026276 |
attatactttcagttcttgaatgatgcttaaatta-ataaaactctcccatacgttatgacatacattcttctcctttcttgtgaaaatatatattagga |
31026178 |
T |
 |
| Q |
110 |
aaaaa-taaataaagagatatgttacatactgcaaaaagggacttcgtgaacaattcatgaatttgtcggtaaattaatgaccattagatttcatagtta |
208 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
31026177 |
aaaaaataaataaagagatatgttacatactgcaaaaagggacttcgtgaacaactcatgaatttgttggtaaattaatggccattagatttcatagtta |
31026078 |
T |
 |
| Q |
209 |
tttgtcttcttcat |
222 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31026077 |
tttgtcttcttcat |
31026064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 265
Target Start/End: Original strand, 35504241 - 35504269
Alignment:
| Q |
237 |
gggtcctgctaaccggtgcccccggacac |
265 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35504241 |
gggtcctgctaaccggtgcccccggacac |
35504269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University