View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4727_high_29 (Length: 233)
Name: NF4727_high_29
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4727_high_29 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 34260549 - 34260356
Alignment:
| Q |
21 |
gaagaaaatatctaaactcatcactcctttaaagaaatctccactcaaacatgaatcagctcagaagtccatggatcaattaaagttgcaggtaattaca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34260549 |
gaagaaaatatctaaactcatcactcctttaaagaaatctccactcaaacatgaatcagctcacaagtccatggatcaattaaagttgcaggtaattaca |
34260450 |
T |
 |
| Q |
121 |
cttatgtgtcggggtc-gacaccgaacacgcctaatctaatgagtgtctatgcttcatagtttcaaacatgttagttactctgtgatatgattg |
213 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34260449 |
cttatgtgtcggggtcggacaccggacacgcctaatctaatgagtgtctatgcttcatagtttcaaacatgttagttagtctatgatatgattg |
34260356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University