View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4727_low_14 (Length: 306)
Name: NF4727_low_14
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4727_low_14 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 182; Significance: 2e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 77 - 290
Target Start/End: Complemental strand, 31557697 - 31557484
Alignment:
| Q |
77 |
ggggtgtggtctttgacaaaggttcatctccttttctatttttgatagcaatcgaaaggtcgaattctatgctaaatgagtctattttgaaaaatttctt |
176 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
31557697 |
ggggtgtggtctttgacaaaggttcgtttccttttctatttttgatagcaatggaatggtcgaattctatgctaaatgagtctattttgaaaaatttgtt |
31557598 |
T |
|
| Q |
177 |
ttatgggttcaaggtgggttgggaggagaatctcttatttttagtttgatgatgatactttgataatatgagataagtcttggtccaatatttgatcgat |
276 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
31557597 |
ttatgggttcaaggtgggctgggaggagaatctcttatttttagtttgatgatgatactttgataatatgagataagtcttgatccaacatttgatcgat |
31557498 |
T |
|
| Q |
277 |
aaaaacttctatgc |
290 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
31557497 |
aaaaacttctatgc |
31557484 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 18 - 79
Target Start/End: Complemental strand, 31558266 - 31558205
Alignment:
| Q |
18 |
aaaaagactatgcaaaatactaaaatacatcttatgatgaggagacattagaggaaaaaggg |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31558266 |
aaaaagactatgcaaaatactaaaatacatcttatgatgaggagacattagaggaaaaaggg |
31558205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University