View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4727_low_25 (Length: 245)
Name: NF4727_low_25
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4727_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 17 - 236
Target Start/End: Original strand, 41942217 - 41942436
Alignment:
| Q |
17 |
catgttacatgtgtaaggaccttgtcaaattcaatccatccgctttctatggtcagtgaaactatattacttacatgaacttcatttccttttggtttgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41942217 |
catgttacatgtgtaaggaccttgtcaaattcaatccatccgctttctatggtcagtgaaactatattacttacatgaacttcatttccttttggtttgg |
41942316 |
T |
 |
| Q |
117 |
gccacttttgctaaagttataagttgaatatttcaatgtctttcccatcaacaatctaattttaaccatccatgaaagcaatatgtgtttttcaactcac |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||| |
|
|
| T |
41942317 |
gccacttttgctaaagttataagttgaatatttcaatgtctttcccatcaacaatctaattttaaccatccatggaagcaatatgtgtttttcaacccac |
41942416 |
T |
 |
| Q |
217 |
ttgagtcggtttgatgatgt |
236 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
41942417 |
ttgagtcggtttgatgatgt |
41942436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University