View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4727_low_32 (Length: 233)

Name: NF4727_low_32
Description: NF4727
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4727_low_32
NF4727_low_32
[»] chr8 (1 HSPs)
chr8 (21-213)||(34260356-34260549)


Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 21 - 213
Target Start/End: Complemental strand, 34260549 - 34260356
Alignment:
21 gaagaaaatatctaaactcatcactcctttaaagaaatctccactcaaacatgaatcagctcagaagtccatggatcaattaaagttgcaggtaattaca 120  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
34260549 gaagaaaatatctaaactcatcactcctttaaagaaatctccactcaaacatgaatcagctcacaagtccatggatcaattaaagttgcaggtaattaca 34260450  T
121 cttatgtgtcggggtc-gacaccgaacacgcctaatctaatgagtgtctatgcttcatagtttcaaacatgttagttactctgtgatatgattg 213  Q
    |||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||    
34260449 cttatgtgtcggggtcggacaccggacacgcctaatctaatgagtgtctatgcttcatagtttcaaacatgttagttagtctatgatatgattg 34260356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University