View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4728_low_3 (Length: 236)
Name: NF4728_low_3
Description: NF4728
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4728_low_3 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 21 - 223
Target Start/End: Complemental strand, 31010505 - 31010303
Alignment:
| Q |
21 |
tgatgtcattgtagagacctcactatcctttatattgcagccgcaaacagtttaaaaccatgatcaagagattttattgtttaatcaagcctgacggtaa |
120 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31010505 |
tgatgtcattgtagagacctcaatatcctttatattgcggccgcaaacaatttaaaaccatgattaagagattttattgtttaatcaagcctgagggtaa |
31010406 |
T |
 |
| Q |
121 |
aaaatatcaattaggcaagaccaagttcccaacactgcaataacaatcccaaacaccataattgctccatcaaaaaccaaacatttccaacccaattcat |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31010405 |
aaaatatccattaggcaagaccaagttcccaacactgcaataacaatcccaaacaccataattgctccatcaaaaaccaaacatttccaacccaattcat |
31010306 |
T |
 |
| Q |
221 |
ctc |
223 |
Q |
| |
|
||| |
|
|
| T |
31010305 |
ctc |
31010303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University