View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4730-Insertion-10 (Length: 340)
Name: NF4730-Insertion-10
Description: NF4730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4730-Insertion-10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 1e-90; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 8 - 200
Target Start/End: Complemental strand, 36576646 - 36576455
Alignment:
| Q |
8 |
cattcttgcaagtcaccatgatcatttgagttatcaatattagccatacgatgcatatgttccccataataataagattatgtaattatttggttttaat |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36576646 |
cattattgcaagtcaccatgatcatttgagttatcaatattagccatacgatgcatatgttccccataataataagattatgtaattatttggttttaat |
36576547 |
T |
|
| Q |
108 |
tcttttggagaagttttatatatgtatcgggccagtccaataattttaataaataaatgagagcaaaagcaaaattttaatatatgtagcctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
36576546 |
tcttttggagaagttttatatatgtatcgggtcagtccaataatttttaaaaataaatgagagcaaaagcaaaa-tttaatatatgtagcctc |
36576455 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 272 - 340
Target Start/End: Complemental strand, 36576380 - 36576312
Alignment:
| Q |
272 |
cgttggtatgtatgtggcttttaacgtgtctgagtatacatacaaatattttaatttcttaacgatggt |
340 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
36576380 |
cgttggtatgtatgtggcttttaacgtgtctgagtatacataaaaatattttaatttctcaacaatggt |
36576312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 11 - 66
Target Start/End: Complemental strand, 36564014 - 36563959
Alignment:
| Q |
11 |
tcttgcaagtcaccatgatcatttgagttatcaatattagccatacgatgcatatg |
66 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||| |||| | ||||||||| |
|
|
| T |
36564014 |
tcttgcaagtcaccatgataatttgggttatcaatattaaccatgctatgcatatg |
36563959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University