View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4730-Insertion-15 (Length: 97)
Name: NF4730-Insertion-15
Description: NF4730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4730-Insertion-15 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 78; Significance: 7e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 78; E-Value: 7e-37
Query Start/End: Original strand, 8 - 97
Target Start/End: Original strand, 41023985 - 41024074
Alignment:
| Q |
8 |
atagcaaaggtttaaaatatcagtcatagtaactgttgtggtcaaatgtgcctggtgcggcctcgatcgtggtcgcgttgcggttatgac |
97 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
41023985 |
atagcaaaggtttaaaatatcagtcatagtaactgttgtggtcaaatgtgcctggtgcggcctcaatcatggtcgcgttgtggttatgac |
41024074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University