View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4730_high_4 (Length: 356)
Name: NF4730_high_4
Description: NF4730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4730_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 338; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 338; E-Value: 0
Query Start/End: Original strand, 1 - 342
Target Start/End: Original strand, 52926088 - 52926429
Alignment:
| Q |
1 |
agcatttactctggtgattgcggagcggtgagcacgatcctcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaacg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926088 |
agcatttactctggtgattgcggagcggtgagcacgatcttcaacttcaatagcaagttgaacaagaccaccttcaagagtggaaatgcagggtggaacg |
52926187 |
T |
|
| Q |
101 |
ggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatagc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926188 |
ggagcatcctgtgggttggtttcagcagcaacagtactgagtgcttggtcaagaacataaatgaaagaggaagaatcgaagtcttgttgagagcgatagc |
52926287 |
T |
|
| Q |
201 |
aaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattgaa |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926288 |
aaacaaagagaccgcaaccgatgcaattcatgcggaattgtttctcgagtttgccttggccacgctttaagagaacgttgccagcttcgtgaatattgaa |
52926387 |
T |
|
| Q |
301 |
tcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
342 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52926388 |
tcttgcaagatgtttggtcttatccaaaacgtaagctctgtc |
52926429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University