View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4731_high_27 (Length: 239)
Name: NF4731_high_27
Description: NF4731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4731_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 202; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 48753422 - 48753635
Alignment:
| Q |
8 |
aagcaaaggtggtcatatgcatgtgctaagcaattgattgagaggttgatttatggagaaggtgatgaaaatgggttggaatttacaattgtgagacctt |
107 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48753422 |
aagcaaagatggtcatatgcatgtgctaagcaattgattgagaggttgatttatggagaaggtgatgaaaatgggttggaatttacaattgtgagacctt |
48753521 |
T |
 |
| Q |
108 |
ttaattggattggaccgagaatggatttcattcatggtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcagcaacaatcttcttcg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48753522 |
ttaattggattggaccgagaatggatttcattcctagtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcagcaacaatcttcttcg |
48753621 |
T |
 |
| Q |
208 |
aggagagccgttga |
221 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
48753622 |
aggagagccgttga |
48753635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 8 - 221
Target Start/End: Original strand, 49052057 - 49052270
Alignment:
| Q |
8 |
aagcaaaggtggtcatatgcatgtgctaagcaattgattgagaggttgatttatggagaaggtgatgaaaatgggttggaatttacaattgtgagacctt |
107 |
Q |
| |
|
|||||||| ||||| ||||||||||| ||||| |||||||| |||||||||||||| |||||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
49052057 |
aagcaaagatggtcgtatgcatgtgcgaagcagttgattgaaaggttgatttatggtgaaggtgatgaaaaggggttggagtttacaattgtgaggcctt |
49052156 |
T |
 |
| Q |
108 |
ttaattggattggaccgagaatggatttcattcatggtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcagcaacaatcttcttcg |
207 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49052157 |
ttaattggattgacccgagaatggatttcattcctggtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcagcaacaatcttcttcg |
49052256 |
T |
 |
| Q |
208 |
aggagagccgttga |
221 |
Q |
| |
|
||||||||||||| |
|
|
| T |
49052257 |
tggagagccgttga |
49052270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 17 - 221
Target Start/End: Complemental strand, 18136631 - 18136427
Alignment:
| Q |
17 |
tggtcatatgcatgtgctaagcaattgattgagaggttgatttatggagaaggtgatgaaaatgggttggaatttacaattgtgagaccttttaattgga |
116 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18136631 |
tggtcatatgcatgtgcaaagcaattgattgagaggttgatttatggtgaaggtgatgaaaatgggttggagtttacaattgtgagaccttttaattgga |
18136532 |
T |
 |
| Q |
117 |
ttggaccgagaatggatttcattcatggtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcagcaacaatcttcttcgaggagagcc |
216 |
Q |
| |
|
||||||| ||||||||| || ||| | |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18136531 |
ttggaccaagaatggatctcgttcctagtgttgatggtccaagtgagagagttcctagggttcttgcttgcttcagcaacaatcttcttcgtggagagcc |
18136432 |
T |
 |
| Q |
217 |
gttga |
221 |
Q |
| |
|
||||| |
|
|
| T |
18136431 |
gttga |
18136427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 48; Significance: 1e-18; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 68 - 195
Target Start/End: Complemental strand, 20489087 - 20488960
Alignment:
| Q |
68 |
ggtgatgaaaatgggttggaatttacaattgtgagaccttttaattggattggaccgagaatggatttcattcatggtgttgatggtccaagtgagggag |
167 |
Q |
| |
|
|||| |||||| || ||||| || ||||||||||| || ||||||||||| ||||| |||||||| ||||||| ||| |||| || ||||||||||| | |
|
|
| T |
20489087 |
ggtgctgaaaacggcttggagttcacaattgtgaggccctttaattggatcggacctagaatggacttcattcccggtattgacggaccaagtgagggtg |
20488988 |
T |
 |
| Q |
168 |
ttcctagggttcttgcttgcttcagcaa |
195 |
Q |
| |
|
|||| | |||||||| ||||||||||| |
|
|
| T |
20488987 |
ttccccgtgttcttgcatgcttcagcaa |
20488960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 95 - 192
Target Start/End: Original strand, 19389507 - 19389604
Alignment:
| Q |
95 |
attgtgagaccttttaattggattggaccgagaatggatttcattcatggtgttgatggtccaagtgagggagttcctagggttcttgcttgcttcag |
192 |
Q |
| |
|
||||||||||||| ||| ||||||||||| |||||||| ||||||| ||| || |||||||||||||| || || || || ||| | ||||||||||| |
|
|
| T |
19389507 |
attgtgagaccttataactggattggaccaagaatggacttcattcctggagtggatggtccaagtgatggtgtcccaagagttttagcttgcttcag |
19389604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 8 - 63
Target Start/End: Complemental strand, 20489236 - 20489181
Alignment:
| Q |
8 |
aagcaaaggtggtcatatgcatgtgctaagcaattgattgagaggttgatttatgg |
63 |
Q |
| |
|
||||| || ||||||||||||||||| ||||| |||||||||||| || ||||||| |
|
|
| T |
20489236 |
aagcagagatggtcatatgcatgtgcaaagcagttgattgagaggctggtttatgg |
20489181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University