View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4731_low_21 (Length: 298)
Name: NF4731_low_21
Description: NF4731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4731_low_21 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 282
Target Start/End: Complemental strand, 30975449 - 30975179
Alignment:
| Q |
11 |
agaaggaacacagaattagccgaatttccgtcacaaggcaagtattgctcctaaatttagatattgccaagtcacaaaaggannnnnnnnnatttctttt |
110 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30975449 |
agaaggaccacacaattagccgaatttccgtcacaaggcaagtattgctcctaaatttagatattgccaagtcacaaaaggatttttttt-atttctttt |
30975351 |
T |
|
| Q |
111 |
gagctttgacagaagtgaggattaaatgcaaaccatcgcgattctcatatgcacttagtaagtcatgcattcaccaaagcctccaactcaaaaccgaaac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30975350 |
gagctttgacagaagtgaggattaaatgcaaaccatcgcgattctcatatgcacttagtaagtcatgcattcaccaaagcctccaactcaaaaccgaaac |
30975251 |
T |
|
| Q |
211 |
acaaatcaattatgagaatacactacaagattgaagatannnnnnnatgtttttcatcaaataagaatgaac |
282 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
30975250 |
acaaatcaattgtgagaatacactacaagattgaagatatttttttatgtttttcatcaaataaaaatgaac |
30975179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University