View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4731_low_27 (Length: 250)
Name: NF4731_low_27
Description: NF4731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4731_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 32041604 - 32041366
Alignment:
| Q |
1 |
ttcttgattaaaggttttagggttctcagtatttcaatatcttgatgtttgaatttcatttcattgttcttgaatttcatttcattccaaattatattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
32041604 |
ttcttgattaaaggttttagggttctcagtatttcaatatcttgatgtttgaatttcatttcattgttcttgaatttcatttcatttcaaattgtattaa |
32041505 |
T |
 |
| Q |
101 |
ttaacctcttatggatttcaaatgatttggggttgtaaaatctcaaaattaatttagagaatggagaagtttggggttcattttaattctaagtttactt |
200 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
32041504 |
ttaaccttttatggatttcaaatgatttggggttgtaaaatctcaaaattaatttagagaatggagaagtttggggttaattctaattctaagtttactt |
32041405 |
T |
 |
| Q |
201 |
tgatatagtttttactttttatgggtttagatcttctct |
239 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||| |||| |
|
|
| T |
32041404 |
tgatatagtttttattttttataggtttagatctcctct |
32041366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 177 - 213
Target Start/End: Complemental strand, 32031125 - 32031089
Alignment:
| Q |
177 |
ttcattttaattctaagtttactttgatatagttttt |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32031125 |
ttcattttaattctaagtttactttgatatagttttt |
32031089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University