View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4731_low_37 (Length: 223)
Name: NF4731_low_37
Description: NF4731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4731_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 114; Significance: 6e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 97 - 210
Target Start/End: Complemental strand, 12726553 - 12726440
Alignment:
| Q |
97 |
atgtccggtacatcaatgtcatgccctcatgtttctggagtagcagcatatgtgaagtcatttcacccagattggactcctgccgcaatcagatcagcaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12726553 |
atgtccggtacatcaatgtcatgccctcatgtttctggagtagcagcatatgtgaagtcatttcacccagattggactcctgccgcaatcagatcagcaa |
12726454 |
T |
|
| Q |
197 |
taattaccacaggt |
210 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
12726453 |
taattaccacaggt |
12726440 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 116 - 210
Target Start/End: Original strand, 34293719 - 34293813
Alignment:
| Q |
116 |
catgccctcatgtttctggagtagcagcatatgtgaagtcatttcacccagattggactcctgccgcaatcagatcagcaataattaccacaggt |
210 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| ||||||| ||||| |||||||||||||| ||||| || |||||| |
|
|
| T |
34293719 |
catgccctcacatttctggaatagcagcatatgtgaagtcatttcacccaaattggacccctgctgcaatcagatcagctataatgactacaggt |
34293813 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 116 - 206
Target Start/End: Original strand, 28521481 - 28521571
Alignment:
| Q |
116 |
catgccctcatgtttctggagtagcagcatatgtgaagtcatttcacccagattggactcctgccgcaatcagatcagcaataattaccac |
206 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||||||| || | ||||||||||| ||||||||||| ||||| || ||||| |
|
|
| T |
28521481 |
catgtcctcatgtcgctggtgtagcagcatatgtgaagtcatttcatcccaaatggactcctgctgcaatcagatctgcaattatcaccac |
28521571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 116 - 171
Target Start/End: Original strand, 18214710 - 18214765
Alignment:
| Q |
116 |
catgccctcatgtttctggagtagcagcatatgtgaagtcatttcacccagattgg |
171 |
Q |
| |
|
|||||||||||||| ||||||| | |||||||||||||||||||| || |||||| |
|
|
| T |
18214710 |
catgccctcatgttgctggagttgttgcatatgtgaagtcatttcatcctgattgg |
18214765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University