View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_high_32 (Length: 211)
Name: NF4732_high_32
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_high_32 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 5 - 184
Target Start/End: Complemental strand, 22198081 - 22197902
Alignment:
| Q |
5 |
cagagaggtgtggagctgatttgactgatgcaaagagatatcatcgccgccataaagtgtgtgagtttcattccaaggcacctgttgtggtggttgcagg |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22198081 |
cagagaggtgtggagctgatttgactgatgcaaagagatatcatcgccgccataaagtgtgcgagtttcattccaaggcacctgttgtggtggttgcagg |
22197982 |
T |
|
| Q |
105 |
gatgaggcagaggttttgtcaacaatgtagcaggtcttcaatcttatatctacaccattttctctaacactcatcaataa |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22197981 |
gatgaggcagaggttttgtcaacaatgtagcaggtcttcaatcttatatctacaccattttctctaacactcatcaataa |
22197902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 79; Significance: 4e-37; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 13 - 139
Target Start/End: Complemental strand, 32974110 - 32973984
Alignment:
| Q |
13 |
tgtggagctgatttgactgatgcaaagagatatcatcgccgccataaagtgtgtgagtttcattccaaggcacctgttgtggtggttgcagggatgaggc |
112 |
Q |
| |
|
|||||||||||||| ||| | |||||||||||||||| |||||||| || |||||| |||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
32974110 |
tgtggagctgatttaactttttcaaagagatatcatcgtcgccataaggtttgtgaggttcattccaaagcatctgttgtggtggttgcagggatgaggc |
32974011 |
T |
|
| Q |
113 |
agaggttttgtcaacaatgtagcaggt |
139 |
Q |
| |
|
| |||||||| |||||||||||||||| |
|
|
| T |
32974010 |
aaaggttttgccaacaatgtagcaggt |
32973984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University