View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4732_low_13 (Length: 362)
Name: NF4732_low_13
Description: NF4732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4732_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 17 - 349
Target Start/End: Original strand, 29649256 - 29649590
Alignment:
| Q |
17 |
caagaaataggttacgtgaattcaagtttatttattgttgatggtacgattgcatggttcgctaaaatggttaaatcatttgtgtagtttatttattgac |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649256 |
caagaaataggttacgtgaattcaagtttatttattgttgatggtgcgattgcatggttcactaaaatggttaaatcatttgtgtagtttatttattgac |
29649355 |
T |
 |
| Q |
117 |
ctatgttggaatttgttgccttaactgcggtccgtaccttgacaccttaattagagaaagtatatgggtgccttactttaaatgtgagcgtttatcacct |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649356 |
ctatgttggaattt-ttgccttaactgcggtccgtaccttgacaccttaattagagaaagtatatgggtgccttactttaaatgtgagcgtttatcacct |
29649454 |
T |
 |
| Q |
217 |
taattacaaacagttttgtggtttggtcaatcttcaccaaacaagttggttttgcacagttcagttaggtctaatctcgaattctaagaacctgttatat |
316 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29649455 |
taattacaaacagttttgtggtttggtcaatcttcaccatacaagttggttttgcagagttcagttaggtctaatctcgaattctaagaacctgttatat |
29649554 |
T |
 |
| Q |
317 |
agtccgt---aggtgagataattttgctttgaccct |
349 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
29649555 |
agtccgtaggaggtgagataattttgctttgaccct |
29649590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University